How to use
- Paste a sequence. Plain letters, numbered lines from a GenBank file or FASTA with > headers all work.
- Pick Reverse complement (the default), Complement (same order, partner bases) or Reverse (same bases, backwards).
- Choose whether the result is written as DNA (T) or RNA (U) and copy it.
How it works
Each base is replaced by its Watson–Crick partner — A↔T (or U), G↔C — and IUPAC codes by the code of the partner set. For the reverse complement the order is reversed too, so the new strand reads 5′ to 3′. Upper and lower case are kept letter by letter, which keeps soft-masked (lowercase) regions visible. Anything that is not a nucleotide code stops the conversion with a message naming the character.
Worked example
The sample sequence ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG (39 bases) gives the reverse complement
CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT
Read from the end: the last base G becomes C, then A→T, T→A … up to the first base A, which becomes T at the end.
Tips
- To design a reverse primer, take the reverse complement of the target region at the 3′ end of your amplicon.
- Complement without reversing is rarely what a lab protocol means by “the other strand”: it reads 3′ → 5′.
- Typos such as O for 0 or a stray letter are flagged rather than silently dropped, so the length stays right.