Primer melting temperature (Tm) calculator
Type a primer sequence to estimate its melting temperature. Primers shorter than 14 nucleotides use the Wallace rule, longer ones the basic GC-content formula; both values, the GC content and the base counts are shown.
Runs in your browser: nothing you enter is sent anywhere.
How to use
- Type or paste the primer from 5′ to 3′. Upper or lower case, spaces and position numbers do not matter.
- Read the melting temperature and which formula gave it.
- Compare forward and reverse primers: their Tm values should be close, usually within a few degrees.
- Wallace rule (length N < 14): Tm = 2 × (A + T) + 4 × (G + C) °C.
- Basic GC formula (N ≥ 14): Tm = 64.9 + 41 × (G + C − 16.4) ÷ N °C.
GC content = (G + C) ÷ N × 100 %.
Worked example
The default primer AGCGGATAACAATTTCACACAGGA has 24 bases: A 10, T 4, G 5, C 5, so G + C = 10. Tm = 64.9 + 41 × (10 − 16.4) ÷ 24 = 64.9 − 10.93 = 53.97, shown as 54 °C. GC content is 41.7 %. The Wallace rule would give 2 × 14 + 4 × 10 = 68 °C — far too high for a 24-mer, which is why it is used only for short oligos.
A 10-mer ATGCATGCAT (A 3, T 3, G 2, C 2): 2 × 6 + 4 × 4 = 28 °C by the Wallace rule.
Tips
- Aim for primers of about 18–25 nt with GC content around 40–60 % and Tm values of the pair within a few degrees of each other.
- Avoid runs of four or more identical bases and 3′ ends that are complementary between the two primers.
- For the second primer of a pair, the reverse complement tool turns a target sequence into the primer to order.
Frequently asked questions
Which formula does the calculator use?
For primers shorter than 14 nucleotides, the Wallace rule Tm = 2 °C × (A + T) + 4 °C × (G + C). From 14 nucleotides on, the basic formula Tm = 64.9 + 41 × (G + C − 16.4) ÷ N, where N is the length. The result row says which one was applied; both values are listed.
How accurate is this Tm?
It is a rough estimate. Neither formula accounts for salt or Mg²⁺ concentration, primer concentration or the neighbouring-base effects that nearest-neighbour models include, so values from primer design software or a polymerase supplier's calculator can differ by several degrees.
What annealing temperature should I use?
A common starting point is about 3–5 °C below the lower Tm of the primer pair, then optimising with a gradient PCR. Always follow the recommendation of your polymerase supplier, which often uses its own Tm method.
Why are ambiguous bases not accepted?
A degenerate position (N, R, Y …) can be either a strong G–C or a weak A–T pair, so the formulas cannot give a single Tm. Calculate the Tm for the extreme variants instead.